Search Results: 3 genotypes retrieved

Data download

c.679-22_679dupTCATGATCCCACCCCATTCCAGG

p.(Val228MetfsX30)
Mutation type:Duplication Mutation effect:Frameshift Nucleotide number:679
Genome location:Intron7_Exon8 Subdomain:Serine protease
Alpha missense prediction value: Alpha missense prediction class:
No. of patients reported: 1
Patient information: Monoallelic variation (1); Biallelic variation (0)
Patient Sex Age Genotype PC: amidolytic act (%) PC: clotting act (%) PC: Ag (%) PCD type Clinical presentation (age) First onset age Country Comments Reference
1 NA NA hetero NA NA NA I Other VTE NA France thrombosis (Other VTE) PMID: 10669160

c.679-21_680dupCATCATCCCACCCCATTCCAGGT

p.(Val228IlefsX30)
Mutation type:Duplication Mutation effect:Frameshift Nucleotide number:679
Genome location:Intron7_Exon8 Subdomain:Serine protease
Alpha missense prediction value: Alpha missense prediction class:
No. of patients reported: 7
Patient information: Monoallelic variation (7); Biallelic variation (0)
Patient Sex Age Genotype PC: amidolytic act (%) PC: clotting act (%) PC: Ag (%) PCD type Clinical presentation (age) First onset age Country Comments Reference
1 NA NA hetero 57.1 61 61.7 I Other VTE NA France NA PMID: 32717757
2 NA NA hetero 57.1 61 61.7 I Other VTE NA France NA PMID: 32717757
3 NA NA hetero 57.1 61 61.7 I Other VTE NA France NA PMID: 32717757
4 NA NA hetero 57.1 61 61.7 I Other VTE NA France NA PMID: 32717757
5 NA NA hetero 57.1 61 61.7 I asymptomatic NA France NA PMID: 32717757
6 NA NA hetero 57.1 61 61.7 I asymptomatic NA France NA PMID: 32717757
7 NA NA hetero 57.1 61 61.7 I asymptomatic NA France NA PMID: 32717757

c.683T>A

p.(Val228Asp)
Mutation type:Point Mutation effect:Missense Nucleotide number:683
Genome location:Exon8 Subdomain:Serine protease
Alpha missense prediction value:0.9284 Alpha missense prediction class:pathogenic
No. of patients reported: 4
Patient information: Monoallelic variation (4); Biallelic variation (0)
Patient Sex Age Genotype PC: amidolytic act (%) PC: clotting act (%) PC: Ag (%) PCD type Clinical presentation (age) First onset age Country Comments Reference
1 NA NA hetero 41.7 41.3 35 I Other VTE NA France NA PMID: 32717757
2 NA NA hetero 41.7 41.3 35 I Other VTE NA France NA PMID: 32717757
3 NA NA hetero 41.7 41.3 35 I asymptomatic NA France NA PMID: 32717757
4 NA NA hetero 41.7 41.3 35 I asymptomatic NA France NA PMID: 32717757